View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_70 (Length: 254)
Name: NF6698_low_70
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 25 - 219
Target Start/End: Original strand, 3471008 - 3471206
Alignment:
| Q |
25 |
aaggttccataattttgttgagatccaatttttcaaatgataaaataagcgtgttaaattttgtctttgtgtctaaagaat----gatacatttgtgaaa |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3471008 |
aaggttccataattttggtgagatccaatttttcaaatgataaaataagcgtgttaaattttgtctttgtgtctaaagaatgaatgatacatttgtgaaa |
3471107 |
T |
 |
| Q |
121 |
gacttcgtggcaacaacgcatatccacacgaccacatgcacaactaataaactagacaaaacaaccacgtaccaccacctccttttattttctctgata |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3471108 |
gacttcgtggcaacaacacatatccacacgaccacatgcacaactaataaactagacaaaacaaccacgaaccaccacctccttttattttctctgata |
3471206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University