View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6698_low_84 (Length: 241)

Name: NF6698_low_84
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6698_low_84
NF6698_low_84
[»] chr4 (1 HSPs)
chr4 (1-171)||(410360-410530)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 410360 - 410530
Alignment:
1 tttcatctcacttcacatgcctctcactccaactactaacaaggtcttcaatgaaaacacttttgctaagatgaagaagggtgtgagaatcatcaatgtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
410360 tttcatctcacttcacatgcctctcactccaactactaacaaagtcttcaatgacaacacttttgctaagatgaagaatggtgtgagaatcatcaatgtt 410459  T
101 gctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
410460 gctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa 410530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University