View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_89 (Length: 236)
Name: NF6698_low_89
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 4937127 - 4937341
Alignment:
| Q |
16 |
aaaagttgtgttgtatactaaaacaaattgacaccttatattactggtcgggtcctaataggaagcttaatgggcctggcctaaagaataagacatagaa |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4937127 |
aaaagttgtgttgtatagtaaaacaaattgacaccttatattactggttgggtcctaataggaagcttaatgggcctggcctaaagaacaagacatagaa |
4937226 |
T |
 |
| Q |
116 |
atagaataatgagttttgctttttaaacccctataatcaatcaatagataactttttaatggtgtttgttcagttttaacatcatcgaaagataactctc |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4937227 |
atagaataatgagttgtgctttttaaacccctataatcattcaatagataactttttaatggtgtttgttcagttttaacatcatcgaaagataactctc |
4937326 |
T |
 |
| Q |
216 |
atgagatattcttcg |
230 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
4937327 |
atgagatatttttcg |
4937341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University