View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_97 (Length: 229)
Name: NF6698_low_97
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_97 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 85 - 229
Target Start/End: Original strand, 11920797 - 11920941
Alignment:
| Q |
85 |
ttcaaaatgactaattttactgcatatcttctctaatttcactttgcatttttaaagacgcacaaaaaatatgaagaggaaaagaacattgactttgaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11920797 |
ttcaaaatgactaattttactgcatatcttctctaatttcactttgcatttttaaagacgcacaaaaaatatgaagaggaaaagaacattgactttgaag |
11920896 |
T |
|
| Q |
185 |
tattcaatatagggtctattactataatcatttagaagctatatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11920897 |
tattcaatatagggtctattactataatcatttagaagctatatt |
11920941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University