View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6700_high_15 (Length: 238)
Name: NF6700_high_15
Description: NF6700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6700_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 59 - 229
Target Start/End: Original strand, 25584883 - 25585048
Alignment:
| Q |
59 |
gattcagattctattatttaaacatatagtaggattttagaatggnnnnnnnnnnnntaaggttgcatgagaaatacaaatggtgcatgataaacacgta |
158 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| || |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25584883 |
gattcagattctattatttaaacaaatagtagtattttagaaaggaaaaaaaaaa---aaggttgcatgagaaatacaaatggtgcat----aacacgta |
25584975 |
T |
|
| Q |
159 |
gattgaacaataatggtccatccctccctacnnnnnnnnnt--acaaaaacaataatagtccaatttgtgtga |
229 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25584976 |
gattgaacaataatggtctatccctccctacaaaaaaaaaataacaaaaacaataatagtccaatttgtgtga |
25585048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University