View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6700_high_8 (Length: 253)
Name: NF6700_high_8
Description: NF6700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6700_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 60 - 234
Target Start/End: Complemental strand, 36946326 - 36946152
Alignment:
| Q |
60 |
gtgttaacaagtaaagagattactaacaaccttctctgatatttagtgctgctatcggtgaagtaaacgttcccttctgtatcaatgtctacatcattag |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946326 |
gtgttaacaagtaaagagattactaacaaccttctctgatatttagtgctgctatcggtgaagtaaacgttcccttctgtatcaatgtctacatcattag |
36946227 |
T |
|
| Q |
160 |
taaatctaaatggtactccttctgcctcggttgcaagagatgttgcgaaaccaccttgaggccccaccttcataa |
234 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946226 |
taaatctaaatggtactccttctgcttcggttgcaagagatgttgcgaaaccaccttgaggccccaccttcataa |
36946152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University