View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6700_low_25 (Length: 240)
Name: NF6700_low_25
Description: NF6700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6700_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 33116361 - 33116588
Alignment:
| Q |
1 |
atttcttggggatgatgtttacattcttggttcctgaatctaaaggaaaatctttggaagaaatttctggtgaagctgaggaagaaactttggaggctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116361 |
atttcttggggatgatgtttacattcttggttcctgaatctaaaggaaaatctttggaagaaatttctggtgaagctgaggaagaaactttggaggctgg |
33116460 |
T |
|
| Q |
101 |
tattcaagtttaggacctttatttcttaattgagtaattaattttttaagtagtttgtaggaagaaactaggcattgaagttgtagtatttctttattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116461 |
tattcaagtttaggacctttatttcttaattgagtaattaattttttaagtagtttgtaggaagaaactaggcattgaagttgtagtatttctttattta |
33116560 |
T |
|
| Q |
201 |
gtttttcttgacattcatgtgtttggtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33116561 |
gtttttcttgacattcatgtgtttggtt |
33116588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University