View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6700_low_28 (Length: 237)
Name: NF6700_low_28
Description: NF6700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6700_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 4882595 - 4882824
Alignment:
| Q |
1 |
tttaaattatgtttgacccattagtnnnnnnnnttaaataaattgcaggttgacgagttggcatgcaggtcggccctgtctctgccccaccccatttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4882595 |
tttaaattatgtttgacccattagtaaaaaaa-ttaaataaattgcaggttgacgagttggcatgcaggtcggccctgtctctgccccaccccatttttt |
4882693 |
T |
|
| Q |
101 |
caacaagtttaatgggacgagtcaactaaaagcgacaagttcaaaatggaagttcatctggtcaaaaatagcagactaaacaaactggtctgacagattg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | | |||||||||| | || ||||||||| |
|
|
| T |
4882694 |
caacaagtttaacgggacgagtcaactaaaagcggcaagttcaaaatggaagttcatctggtcaaaaataacgggctaaacaaaccgatccgacagattg |
4882793 |
T |
|
| Q |
201 |
aacctgttttactacacctattgatgtccat |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
4882794 |
aacctattttactacacctattgatgtccat |
4882824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University