View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6701_high_17 (Length: 223)

Name: NF6701_high_17
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6701_high_17
NF6701_high_17
[»] chr1 (1 HSPs)
chr1 (72-210)||(52318089-52318227)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 72 - 210
Target Start/End: Original strand, 52318089 - 52318227
Alignment:
72 taaattgataatgttttaggtccctttgaaaagttaattagagggtcaaagattagggaattgagtggtcctgagtactcaaggaaggttatggagaact 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52318089 taaattgataatgttttaggtccctttgaaaagttaattagagggtcaaagattagggaattgagtggtcctgagtactcaaggaaggttatggagaact 52318188  T
172 gtgtagcacacttgaaatcagttggaacttatggagatg 210  Q
    |||| ||||||||||||||||||||||||||||||||||    
52318189 gtgtggcacacttgaaatcagttggaacttatggagatg 52318227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University