View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6701_high_6 (Length: 412)
Name: NF6701_high_6
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6701_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 18 - 181
Target Start/End: Original strand, 54849856 - 54850019
Alignment:
| Q |
18 |
gtttcttgataaggtgtcagtttttctcttgagagaaatctagttacgttcctaactgttttgttggttactcatcactttcgttgatattcatctttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54849856 |
gtttcttgataaggtgtcagtttttctcttgagagaaatctaattacgttcctaactgttttgttggttacttatcactttcgttgatattcatctttga |
54849955 |
T |
|
| Q |
118 |
tcttcaatctttgcaatttttcgcattgaacattacttgttagtgtgtttttggtttcatcacg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54849956 |
tcttcaatctttgcaatttttcgcattgaacattacttgttagtgtgtttttggtttcatcacg |
54850019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 248 - 402
Target Start/End: Original strand, 54850086 - 54850239
Alignment:
| Q |
248 |
cataaagatgttgtgtttgtgttgttcatcattttctggagaaatctttggtgttctcagttttgattgcctcgttatcttcaccaatttctcatatttc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54850086 |
cataaagatgttgtgtttgtgttgttcatcattt-ctggagaaatctttggtgttctcagttttgattgcctcgttatcttcaccaatttctcatatttc |
54850184 |
T |
|
| Q |
348 |
ttggtcttgattttcaacaacgtattcatgttcatcaacaacaatcagattccat |
402 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54850185 |
ttgctcttgattttcaacaacgtattcatgttcatcaacaacaatcagattccat |
54850239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University