View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6701_high_9 (Length: 301)
Name: NF6701_high_9
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6701_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 301
Target Start/End: Complemental strand, 249501 - 249221
Alignment:
| Q |
17 |
aatatatacataatatggtagcagctaattttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249501 |
aatatatacataatatggtagcagctaattttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgc |
249402 |
T |
 |
| Q |
117 |
tgttcagttatccatttgttctcattgctcaatctcccacaaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249401 |
tgttcagttatccatttgttctcattgctcaatctcccacaaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctc |
249302 |
T |
 |
| Q |
217 |
taaacacagttatctcttgccaggtatgtatgcatgtatgtaccaagtaccttgttctttctcatgcaatatacacatggttatt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249301 |
taaacacagttatctcttgccaggtatgt----atgtatgtaccaagtaccttgttctttctcatgcaatatacacatggttatt |
249221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University