View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6701_low_17 (Length: 265)
Name: NF6701_low_17
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6701_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 35722528 - 35722283
Alignment:
| Q |
18 |
taaggataattattgcaaatagtaaaaacactatgtcctgcaaatacaattcaattgatagctctattaacaatggaatgtctggatcagaattggaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35722528 |
taaggataattattgcaaatagtacaaacactatgtcctgcaaatacaattcaattgatagctctattaacaatggaatgtatggatcagaattggaacc |
35722429 |
T |
|
| Q |
118 |
ccattcttcctattttcttcacacatgtagtgtgtgaatatagtcactagcttatttgaagaagaagnnnnnnncgctactaaacaagaacaattgcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35722428 |
ccattcttcctattttcttcacacatgtagtatgtgaatatagtcactagcttatttgaagaagaa-aaaaaaacgctactaaacaagaacaattgcaaa |
35722330 |
T |
|
| Q |
218 |
ttaattaataatttaggttgttataggtggttccatccaacaccaaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35722329 |
ttaattaataatttaggttgttataggtggttccatccaaaaccaaa |
35722283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University