View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6701_low_18 (Length: 258)
Name: NF6701_low_18
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6701_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 13 - 161
Target Start/End: Complemental strand, 52318931 - 52318783
Alignment:
| Q |
13 |
agaaaggatcaaggaagaaattcaaaattgatttcaacaacctactctgtttccnnnnnnnntaaaataaacaactcgaatgaaatgaaatcaacatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52318931 |
agaaaggatcaaggaagaaattcaaaattgattttaacaacctactctgtttccaaagaaaatgaaataaacaactcgaatgaattgaaatcaacatttt |
52318832 |
T |
 |
| Q |
113 |
atcactctgatttgaacaaacaaaacaaatcacttttattgatgaagat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318831 |
atcactctgatttgaacaaacaaaacaaatcacttttattgatgaagat |
52318783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 52318787 - 52318745
Alignment:
| Q |
208 |
aagatttttcatttcatattattgatactaataagaaggtaaa |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318787 |
aagatctttcatttcatattattgatactaataagaaggtaaa |
52318745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University