View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6701_low_21 (Length: 233)
Name: NF6701_low_21
Description: NF6701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6701_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 35722126 - 35721900
Alignment:
| Q |
1 |
actttataggaagatacacaagaatttcccttatgacaagttcgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35722126 |
actttataggaagatacacaagaatttcccttatgacaagttcgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttg |
35722027 |
T |
 |
| Q |
101 |
agaaccctcttgagtgtctattcttctctcc-tttaccaagttgtgactatagtctcttcactcttggatttataggttaaatttatgtgcatttactat |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35722026 |
agaaccctcttgagtgtctattattctctccttttaccaagttgtgactatactcccttcactcttggatttataggttaaatttatgtacatttactat |
35721927 |
T |
 |
| Q |
200 |
tttttggtataattgtgtttactatga |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35721926 |
tttttggtataattgtgtttactatga |
35721900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University