View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6702_high_7 (Length: 275)
Name: NF6702_high_7
Description: NF6702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6702_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 41210101 - 41209836
Alignment:
| Q |
1 |
cagactttgtctggttaattaccttgggcattcctatgtcaggtttgtaaaaacagacatgaattgtgagccgaatacgtaaattatgatcctttattat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41210101 |
cagactttgtctggttaattacctcgggcattcctatgtcaggtttgtaaaaacagacatgaattgtcagccgaatacgtaaattatgatcctttattat |
41210002 |
T |
|
| Q |
101 |
tatggatgaacaatacgagtaagtcacagtaattgccaccaaaataattctagagttgatgtcacaaaattaatataagtaccaaaaatgtctcgattat |
200 |
Q |
| |
|
|||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41210001 |
tatggatggacaatatgaataagtcacagtaattgccaccaaaataattctagagttgatgtcacaaaattaatataagtaccaaaaatgtctcgattat |
41209902 |
T |
|
| Q |
201 |
ttttatacatcgtaaaagtggtagacagaatgtaattattgccccaacttccatgcatagaataat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41209901 |
ttttatacatcgtaaaagtggtagacagaatgtaattattgccccaacttccatacatagaataat |
41209836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University