View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6702_high_8 (Length: 243)

Name: NF6702_high_8
Description: NF6702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6702_high_8
NF6702_high_8
[»] chr7 (1 HSPs)
chr7 (96-161)||(23989221-23989286)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 96 - 161
Target Start/End: Original strand, 23989221 - 23989286
Alignment:
96 gggaattcatgggtaggtctatgtggaataaaatgagtagtctcaaatagataagaggatgatgag 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23989221 gggaattcatgggtaggtctatgtggaataaaatgagtagtctcaaatagataagaggatgatgag 23989286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University