View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6702_high_9 (Length: 207)
Name: NF6702_high_9
Description: NF6702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6702_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 6109509 - 6109338
Alignment:
| Q |
21 |
ggtgggaatagtaaccatggttgttgcagttgagtgggtttcgctgttaacaacattgcaatgctatttcgattgcttgtttgtagattctgtactgttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6109509 |
ggtgggaatagtaaccatggttgttgcagctgagtgggtttcgctgttaacaacattgcaatgctatttcgattgcttgtttgcagattctgtactgttc |
6109410 |
T |
 |
| Q |
121 |
ttgtgggaaatcttcagcttaacctccaaatccaattttatactaatcttttttaaattattactccctttg |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6109409 |
ttgtgggaaatgttcagcttaacctccaaatccaattttatactaatcttttttaaattattactccctttg |
6109338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University