View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6702_low_4 (Length: 487)
Name: NF6702_low_4
Description: NF6702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6702_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 9e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 397 - 474
Target Start/End: Complemental strand, 26895975 - 26895898
Alignment:
| Q |
397 |
acacaggttctagtcctatcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacct |
474 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26895975 |
acacacgttctagtcctatcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacct |
26895898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 80 - 175
Target Start/End: Complemental strand, 9091742 - 9091647
Alignment:
| Q |
80 |
gttgttgggtggcttggatggcgtcttccaagtccttgggggatgggtttgtgggttttggaggcatgtgagtgta-gcaatgaaagcaccaatgat |
175 |
Q |
| |
|
||||||||||||||||||| || || || | ||| || | ||| |||||||| ||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9091742 |
gttgttgggtggcttggatagcctcatcaaggtcttttgtggaagggtttgtaggtttaggaggcat-tgagtgtaggcaatgaaagcaccaatgat |
9091647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 8975911 - 8975960
Alignment:
| Q |
127 |
tttgtgggttttggaggcatgtgagtgtagcaatgaaagcaccaatgatag |
177 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8975911 |
tttgtgggtttgggaggcatg-gagtgcagcaatgaaagcaccaatgatag |
8975960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 121 - 175
Target Start/End: Original strand, 16983640 - 16983694
Alignment:
| Q |
121 |
gatgggtttgtgggttttggaggcatgtgagtgtagcaatgaaagcaccaatgat |
175 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
16983640 |
gatgggtttgatggttttggaggcatgggagttcagcaatgaaagcaccaatgat |
16983694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 133 - 197
Target Start/End: Original strand, 6708769 - 6708832
Alignment:
| Q |
133 |
ggttttggaggcatgtgagtgtagcaatgaaagcaccaatgatagcttttacgtttggggatcaa |
197 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| | |||||| | |||| ||||| |
|
|
| T |
6708769 |
ggttttggaggcatg-gagttcagcaatgaaagcaccaatgatggattttacttatgggaatcaa |
6708832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University