View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6704_low_21 (Length: 210)
Name: NF6704_low_21
Description: NF6704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6704_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 5305904 - 5305709
Alignment:
| Q |
1 |
tcactggttttattgaaatgcacttaccacacccttgattacactgaatcttacgttcatgatcatcactgtaataaaattatcacaattcaagatttat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305904 |
tcactggttttattgaaatggacttaccacacccttgattacactgaatcttacggtcatgatcatcactgtaataaaattatcacaattcaagatttat |
5305805 |
T |
 |
| Q |
101 |
actacttagtagaacttannnnnnnncttttcttagttcatatgaatttttggattcgtatacttattagtaagcttt-gtcgacttagattgatgtc |
197 |
Q |
| |
|
||||||||||| |||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5305804 |
actacttagtataactta--tcctttcttttcttagttgatatgaatttttggatttgtatacttattagtaagctttggtcgacttagattgatgtc |
5305709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University