View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6704_low_9 (Length: 367)
Name: NF6704_low_9
Description: NF6704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6704_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 23 - 347
Target Start/End: Original strand, 26585214 - 26585538
Alignment:
| Q |
23 |
tgtcttggttcaaaagtcaaaacaaacacaatcactcaccaaaatctatgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaagatcg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585214 |
tgtcttggttcaaaagtcaaaacaaacacaatcactcaccaaaatctatgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaagatcg |
26585313 |
T |
|
| Q |
123 |
gtcacaactatgtggagcaacatccttggggatgggtggattcggtaaaacagtgagcattatatcggaatgtcaagacggtgatgctggtaacttttgg |
222 |
Q |
| |
|
| |||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585314 |
gccacaactatgtggagcaacaaccttgggaatgggtggattcggtaaaac--tgagcattatatcggaatgtcaagacggtgatgctggtaacttttgg |
26585411 |
T |
|
| Q |
223 |
ccttgctatgtgaatgcctgcagcaatcaaattggtttgcaggaacaca--attatttttatcacaaagttgctctcgcctgaaaatcatctcatcagcc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585412 |
ccttgctatgtgaatgcctgcagcaatcaaattggtttgcaggaacacacgattatttttgtcacaaagttgctctcgcctgaaaatcatctcatcagcc |
26585511 |
T |
|
| Q |
321 |
aagcaccatttctaaatgtccttcttg |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26585512 |
aagcaccatttctaaatgtccttcttg |
26585538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 54 - 118
Target Start/End: Original strand, 26585599 - 26585663
Alignment:
| Q |
54 |
tcactcaccaaaatctatgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaag |
118 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26585599 |
tcactcaccaaaatccatgttaaacaaacttttgtttggttttctctcctcacaaaatcaccaag |
26585663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 93
Target Start/End: Complemental strand, 26979444 - 26979390
Alignment:
| Q |
39 |
tcaaaacaaacacaatcactcaccaaaatctatgtcaaacaaactttggtttggt |
93 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26979444 |
tcaaaataaacacactcattcaccaaaatccatgtcaaacaaactttggtttggt |
26979390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 7e-31; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 116 - 216
Target Start/End: Original strand, 8269529 - 8269628
Alignment:
| Q |
116 |
aagatcggtcacaactatgtggagcaacatccttggggatgggtggattcggtaaaacagtgagcattatatcggaatgtcaagacggtgatgctggtaa |
215 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||| || ||||||||||| |
|
|
| T |
8269529 |
aagatcggccacaactatgtggaacaacatccttggggatgggcggattcggtaaaacagtgagcattatct-ggaatgtcaagaaggcgatgctggtaa |
8269627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 39 - 118
Target Start/End: Original strand, 8288315 - 8288394
Alignment:
| Q |
39 |
tcaaaacaaacacaatcactcaccaaaatctatgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8288315 |
tcaaaacaaacacaatcactcaccaaaatccatgtcaaacaaactttggtttggcttggtctcctcacaaaatcaccaag |
8288394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 116 - 174
Target Start/End: Original strand, 8287827 - 8287885
Alignment:
| Q |
116 |
aagatcggtcacaactatgtggagcaacatccttggggatgggtggattcggtaaaaca |
174 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||| || ||||||||||||||||||||| |
|
|
| T |
8287827 |
aagatcagtcacaactatgtggatcgacatccttaggcatgggtggattcggtaaaaca |
8287885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 116 - 179
Target Start/End: Original strand, 1250770 - 1250833
Alignment:
| Q |
116 |
aagatcggtcacaactatgtggagcaacatccttggggatgggtggattcggtaaaacagtgag |
179 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1250770 |
aagatcggccacaactatgtggagcaacatccttggggatgggtggattcggtaaaacattgag |
1250833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 37646722 - 37646769
Alignment:
| Q |
300 |
ctgaaaatcatctcatcagccaagcaccatttctaaatgtccttcttg |
347 |
Q |
| |
|
||||||||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
37646722 |
ctgaaaatcatttaatcagccaagcacgatttctaaatgtccttcttg |
37646769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 217 - 255
Target Start/End: Original strand, 37645166 - 37645204
Alignment:
| Q |
217 |
ttttggccttgctatgtgaatgcctgcagcaatcaaatt |
255 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37645166 |
ttttggcctggctatgtgaatgcctgcagcaatcaaatt |
37645204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 219 - 255
Target Start/End: Original strand, 19827092 - 19827128
Alignment:
| Q |
219 |
ttggccttgctatgtgaatgcctgcagcaatcaaatt |
255 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19827092 |
ttggcctggctatgtgaatgcctgcagcaatcaaatt |
19827128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 257 - 297
Target Start/End: Original strand, 37646650 - 37646692
Alignment:
| Q |
257 |
gtttgcaggaacaca--attatttttatcacaaagttgctctc |
297 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37646650 |
gtttgcaggaacacactattatttttatcacaaagttgctctc |
37646692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University