View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6705_low_11 (Length: 235)
Name: NF6705_low_11
Description: NF6705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6705_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 49156341 - 49156210
Alignment:
| Q |
1 |
cgagtttggtgttggaagttgctcagcatttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgttgttcgtggatggcgtgttct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49156341 |
cgagattggtgttggaagttgctcagcatttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgttgttcgtggatggcgtgttct |
49156242 |
T |
|
| Q |
101 |
taacaccggttctcccatcagtgtaaatatct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49156241 |
taacaccggttctcccatcagtgtaaatatct |
49156210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 6 - 129
Target Start/End: Complemental strand, 49160511 - 49160388
Alignment:
| Q |
6 |
ttggtgttggaagttgctcagcatttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgttgttcgtggatggcgtgttcttaaca |
105 |
Q |
| |
|
||||||||||| ||||| || ||| |||||||||||||||||||||| |||||||||||||| |||||||| |||||| | || ||||||||||| |||| |
|
|
| T |
49160511 |
ttggtgttggaggttgcacaacatatgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgttagagggtggcgtgttctcaaca |
49160412 |
T |
|
| Q |
106 |
ccggttctcccatcagtgtaaata |
129 |
Q |
| |
|
|||| || || ||||||||||||| |
|
|
| T |
49160411 |
ccggctcccctatcagtgtaaata |
49160388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 199 - 235
Target Start/End: Complemental strand, 49156143 - 49156107
Alignment:
| Q |
199 |
tgagatctgattttgaaatcattgcggtttgaatttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49156143 |
tgagatctgattttgaaatcattgcggtttgaatttt |
49156107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 45639352 - 45639271
Alignment:
| Q |
1 |
cgagtttggtgttggaagttgctcagcatttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgttgt |
82 |
Q |
| |
|
|||| |||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45639352 |
cgagattggtgttggaactgactcagcatttgggtgaaggtgttgtgagaaccattgctatggatgctactgaaggtgttgt |
45639271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 6619344 - 6619292
Alignment:
| Q |
27 |
catttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgt |
79 |
Q |
| |
|
|||||| |||||||||| ||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
6619344 |
catttgcgtgaaggtgtaatgagaacaattgatatggatgctaatgaaggtgt |
6619292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University