View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6707_high_3 (Length: 473)
Name: NF6707_high_3
Description: NF6707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6707_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 20194178 - 20193928
Alignment:
| Q |
10 |
ggacatcaaaggcaaatgatggttccggaacttccaatgcaggtcacccaagggaacagccaaggcattcctgcctttagtgggatgagttctgctttta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20194178 |
ggacatcaaaggcaaatgatggttccggaacttccaatgcaggtcacccaagggaacagccaaggcattcctgcctttagtgggatgagttctgctttta |
20194079 |
T |
|
| Q |
110 |
atagtcaaacaactcccccatcggttcagcaataccccgtacatgcccaacaacagtctcatcttagcaatccccatcctcatcttcaaggtccgaatca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20194078 |
atagtcaaacaactcccccatcggttcagcaataccccgtacatgcccaacaacagtctcatcttagcaatccccatcctcatcttcaaggtccgaatca |
20193979 |
T |
|
| Q |
210 |
ccctaacaatcaacagcaagcctatacccgattggcaaaggaaaggcaact |
260 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
20193978 |
ccctaacaatcaacaacaagcctatatccgattggcaaaggaaaggcaact |
20193928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 305 - 461
Target Start/End: Complemental strand, 20193886 - 20193730
Alignment:
| Q |
305 |
tttctgcgacaaatgctttgattccacatgttcaggcacaagcccaacctcccatatcatcacctcagcaaaatagttcccaggcgcaaccacaaaattc |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20193886 |
tttctgcgacaaatgctttgattccacatgttcaggcacaagcccaacctcccatatcatcacctcagcaaaatagttcccaggcgcaaccacaaaattc |
20193787 |
T |
|
| Q |
405 |
atctcagcaagtatctgtttcccctgcaacaccatcatctcctttgactctgatgtc |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20193786 |
atctcagcaagtatctgtttcccctgcaacaccatcatctcctttgactccgatgtc |
20193730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University