View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6707_low_12 (Length: 401)
Name: NF6707_low_12
Description: NF6707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6707_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 19171156 - 19171537
Alignment:
| Q |
1 |
ataggagcagcatcagcagtagcagcaacatcaattctctcagcaaaaccaaaagacccaacattccatctcatctccatcaacttcacctccttaaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
19171156 |
ataggagcagcatcagcagtagcagcaacatcaattctctcagcaaaaccaaaagacccaacatttcatctcatctccatcaacttcacttccttaaaac |
19171255 |
T |
|
| Q |
101 |
caagcctccccgttgtagacgcagaagttcttctaactgtccatgtcaccaatccaaacatagccccaattaactactcatcaacaaccatgtcaatttt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171256 |
caagcctccccgtcgtagacgcagaagttcttttaaccgtccatgtcaccaatccaaacatagctccaattaactactcatcaacaaccatgtcaatttt |
19171355 |
T |
|
| Q |
201 |
ctacgaaggttctctcctcggttcagctccggtccaagccgggtctcagccaccgaggtcatgtcagttactgagacttccggctcggcttaaagctctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
19171356 |
ctacgaaggttctctcctcggttcagctccggtccaagccgggtctcagccaccgaggtcatgtcagttactgagacttcctgcccggcttaaagctctt |
19171455 |
T |
|
| Q |
301 |
cggctcgcgaaacacgcgagccgagtaatgtctgacgtggcgaaaagggagatggttcttgatgcggctgttgatattgctg |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19171456 |
cggctcgcgaaacacgcgagccgagtaatgtctgacgtggcgaaaagggagatggttcttgatgcagctgttgatattgctg |
19171537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University