View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6707_low_23 (Length: 247)
Name: NF6707_low_23
Description: NF6707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6707_low_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 32928382 - 32928615
Alignment:
| Q |
17 |
catcagaccaagaaatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgtattgtgtgatnnnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32928382 |
catcagaccaagaaatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgtattgtgtgaagaagaagaa |
32928481 |
T |
|
| Q |
117 |
nnnnnnnn---tgactagggttcgaatccctccttgaactgtaaattttaatctattaataattctattttttcagcatgatcgcgctcgctcgctacga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
32928482 |
gaagaagaagatgactagggttcgaatccctccttgaactgtaaattttaatctattaataattcaattttttcagtgtgttcgcgctcgctcgctacga |
32928581 |
T |
|
| Q |
214 |
tgaagaaaatatatattcagaaaacgagaaaaca |
247 |
Q |
| |
|
|||| | ||||||||| ||||||||||||||||| |
|
|
| T |
32928582 |
tgaaaacaatatatatacagaaaacgagaaaaca |
32928615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 97
Target Start/End: Complemental strand, 1483344 - 1483268
Alignment:
| Q |
21 |
agaccaagaaatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgt |
97 |
Q |
| |
|
||||||| ||||| ||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1483344 |
agaccaaacaatggagtttggaaaacaaggtgaacccattagcatcgctgactgtaacggagttggacccatgttgt |
1483268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University