View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_high_17 (Length: 244)
Name: NF6708_high_17
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 33940385 - 33940618
Alignment:
| Q |
1 |
ttatttgtaagtttgctttagtattcatagttgacttttcaatactaatctctgagcttgttacttcttaaatatgttaattcgtatattaaatctcata |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940385 |
ttatttgtaagtgtgctttagtattcatagttgacttttcaatactagtctctgagcttgttacttcttaaatatgttaattcgtatattaaatctcata |
33940484 |
T |
 |
| Q |
101 |
tttgtc-tgggtttatgcatgaggggacttacgctttatatttttgacaatttctcattgcagatttttctatgcttttgcacaactttgtttctattcc |
199 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940485 |
tttgtcctggctttatgcatgaggggacttacgctttatatttttgaaaattgctcattgcagatttttctatgcttttgcacaactttgtttctattcc |
33940584 |
T |
 |
| Q |
200 |
cttgtttatctcatgatatatattgcttgatgtc |
233 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| |
|
|
| T |
33940585 |
cttgcttatctcatgatgtatattgcttgatgtc |
33940618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 33940161 - 33940227
Alignment:
| Q |
20 |
agtattcatagttgacttttcaatactaatctctgagcttgttacttcttaaatatgttaattcgta |
86 |
Q |
| |
|
|||| ||||| ||||||||||||||| | ||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
33940161 |
agtaatcatacttgacttttcaatacaagtcttgtagcttgttgcatcttaaatatgttaattcgta |
33940227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University