View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_low_22 (Length: 361)
Name: NF6708_low_22
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 346
Target Start/End: Original strand, 41538365 - 41538694
Alignment:
| Q |
18 |
tgtggtgaacacactgattcatttttggcttgttgacaatgatttctcaccgtttccggtgagtgtatgtaaaacaatgggtgtatcgtttccgttcggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538365 |
tgtggtgaacacactgattcatttttggcttgttgacaatgatttctcaccgtttccggtgagtgtatgtaaaacaatgggtgtatcgtttccgttcggg |
41538464 |
T |
|
| Q |
118 |
gaaattccaccggctgcggggttaggggaagttgtgaagctgtttgttaggtatttgggtttgagcactttagcagcgtcttgtgagaatggaga-tttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41538465 |
gaaattccaccggctgcggggttaggggaagttgtgaagctgtttgttaggtatttgggtttgagcactttagcagcgtcttgtgagaatggagattttg |
41538564 |
T |
|
| Q |
217 |
gttatagttaaaattctagtcctagatggagaagtttagaggtttcgaagaataaggatttaggttatggctgttggaatcagtgtttgcagaggccttt |
316 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538565 |
gttatagttacaattctagtcctagatggagaagtttagaggtttcgaagaataaggatttaggttatggctgttggaatcagtgtttgcagaggccttt |
41538664 |
T |
|
| Q |
317 |
gtataggtttttgttgaggacgttgttgtt |
346 |
Q |
| |
|
||||||||||||| ||||||| |||||||| |
|
|
| T |
41538665 |
gtataggtttttgctgaggacattgttgtt |
41538694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University