View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_low_40 (Length: 238)
Name: NF6708_low_40
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 50 - 221
Target Start/End: Complemental strand, 6739379 - 6739210
Alignment:
| Q |
50 |
taatatactcgaacacacattcgaaagcagtatgacactgatcatatatcatatattacttgagaggcgatcgagtttcattatactatcgacgaggacg |
149 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739379 |
taatatactcgaacgcacgttcgaaagcagtatgacactgatcatatatcatat--tacttgagaggcgatcgagtttcattatactatcgacgaggacg |
6739282 |
T |
|
| Q |
150 |
aaactgacatttaattcggtacattaatttcaaaatgaatatgatgatgcacttgtcgtggagataattttc |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739281 |
aaactgacattttattcggtacattaatttcaaaatgaatatgatgatgcacttgtcgtggagataattttc |
6739210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 6739492 - 6739450
Alignment:
| Q |
9 |
ccgatacagttttgttggccgaaatcagtcttcattattggta |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739492 |
ccgatacagttttgttggccgaaatcagtcttcattattggta |
6739450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University