View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_low_41 (Length: 236)
Name: NF6708_low_41
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_low_41 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 236
Target Start/End: Complemental strand, 14937611 - 14937379
Alignment:
| Q |
4 |
gacatcaacattttaattacttcaagaccaaaagtattgaaacccaggtagcagtcgatcctaaaaacaccagtgaggacggtgaaacgtagcaagagtg |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14937611 |
gacatcgacattttaattacttcaagaccaaaagtattgaaacccaggtagcagtcgatcctaaaaacaccagtgaggacggtgaaacgtagcaagagtg |
14937512 |
T |
|
| Q |
104 |
agagacaaagtgagagaagggaagcagtaatattatatttgtgttttataattgcaaaatttatcaaataccccaaacaaaagtccctaaaattaaaatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14937511 |
agagacaaagtgagagaagggaagcagtaatattatatttgtgttttataattgcaaaatttatcaaataccccaaccaaaagtccctaaaattaaaatt |
14937412 |
T |
|
| Q |
204 |
attaagttttatttttggaatgctatatcattt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14937411 |
attaagttttatttttggaatgctatatcattt |
14937379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University