View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_low_42 (Length: 236)
Name: NF6708_low_42
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 32650280 - 32650051
Alignment:
| Q |
1 |
aaattgtctgcaactaataagacaaccttnnnnnnnnggtcataaatgcagttcagcacatagaaatgcaaaatctatgacaaaaacacactccccatta |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32650280 |
aaattgtctgcaactcataagacaaccttaaaaaaa-ggtcatatatgcagttcaacacatagaaatgcaaaatatatgacaaaaacacactccccatta |
32650182 |
T |
 |
| Q |
101 |
acttttaaagtaatagcaggttccaaatgaaatagggacgatccacatgttccaaattgcagtgtatatggatagaagctttcaaaagcttacaagttat |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32650181 |
acttt-aaagtaatagcaggttccaaatgaaatagggacgatctacatgttccaaattgcagtctatatggatagaagctttcaaaagcttacatgttat |
32650083 |
T |
 |
| Q |
201 |
tttcctgcattttgg-tttgtgccattgatgt |
231 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |
|
|
| T |
32650082 |
tttcctgcattttggttttgtgcgattgatgt |
32650051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 2388423 - 2388386
Alignment:
| Q |
173 |
tagaagctttcaaaagcttacaagttattttcctgcat |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2388423 |
tagaagctttggaaagcttacaagttattttcctgcat |
2388386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University