View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6708_low_45 (Length: 228)
Name: NF6708_low_45
Description: NF6708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6708_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 38 - 214
Target Start/End: Complemental strand, 50759611 - 50759435
Alignment:
| Q |
38 |
taaccctttcgatgaaaaatttacaactttttcatgcatgcgtgccattagtcatcgatccaataactcgccatagacannnnnnnnatcaaaaaggttt |
137 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50759611 |
taaccctttcgatgaaaaattcacaactgtttcatgcatgcgtgccattagtcattgatccaataactcgccatagacattttttttatcaaaaaggttt |
50759512 |
T |
 |
| Q |
138 |
tggctgttgcataattcttgcttgatatatttgtttgttatgcactctcatctaccgttgaagttacaataataact |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50759511 |
tggctgttgcataattcttgctcgatatatttgtttgttatgcactctcatctaccgttgaagttacaataataact |
50759435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University