View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6709_high_14 (Length: 233)
Name: NF6709_high_14
Description: NF6709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6709_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 40099672 - 40099882
Alignment:
| Q |
5 |
atgtcgaagaatatatcttagagggtgtaatgtcaacannnnnnnatacttgcaaacaaaatgcatggttgtgatttttgacttgcttatgcagtatgag |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40099672 |
atgttgaagaatatatcttagagggtgtaatgtcaacatttttttatacttgcaaacaaaatgcatggttgtgatttttgactggcttatgcagtatgag |
40099771 |
T |
|
| Q |
105 |
tttagtggaaggtttgatttagtgggattcattaaagaaattcaagcacaaggtttatatgtgacccttcgaattggaccatacattgagagtgaatgca |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40099772 |
tttaatggaaggtttgatttagtgggattcattaaagaaattcaagcacaaggtttatatgtgacccttcgaattggaccatatattgagagtgaatgca |
40099871 |
T |
|
| Q |
205 |
cttatgggtaa |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
40099872 |
cttatgggtaa |
40099882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University