View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6709_low_16 (Length: 233)

Name: NF6709_low_16
Description: NF6709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6709_low_16
NF6709_low_16
[»] chr3 (1 HSPs)
chr3 (5-215)||(40099672-40099882)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 40099672 - 40099882
Alignment:
5 atgtcgaagaatatatcttagagggtgtaatgtcaacannnnnnnatacttgcaaacaaaatgcatggttgtgatttttgacttgcttatgcagtatgag 104  Q
    |||| |||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40099672 atgttgaagaatatatcttagagggtgtaatgtcaacatttttttatacttgcaaacaaaatgcatggttgtgatttttgactggcttatgcagtatgag 40099771  T
105 tttagtggaaggtttgatttagtgggattcattaaagaaattcaagcacaaggtttatatgtgacccttcgaattggaccatacattgagagtgaatgca 204  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40099772 tttaatggaaggtttgatttagtgggattcattaaagaaattcaagcacaaggtttatatgtgacccttcgaattggaccatatattgagagtgaatgca 40099871  T
205 cttatgggtaa 215  Q
    |||||||||||    
40099872 cttatgggtaa 40099882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University