View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6709_low_17 (Length: 228)
Name: NF6709_low_17
Description: NF6709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6709_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 22451528 - 22451746
Alignment:
| Q |
1 |
ataaaaaactgtatagtttagtttgtagttgatttaatttggaaaaaccaattaccttttttcactcgttnnnnnnnnccacaaaaatgtacattattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22451528 |
ataaaaaactgtatagtttagtttgtagttgatttaatttggaaaaaccaattaccttttttcactcgttaaaaaaaaccacaaaaatgtacattattaa |
22451627 |
T |
|
| Q |
101 |
acttctttttaacatatataaataacattaaccacttatattgcataaatatatgtacttatgtcattttgcaactatgttgctttaatttacatttcat |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22451628 |
acctctttttaacatatataaataacattaaccacttatattgcataaatatatgtacttatgtcattt--------tgttgctttaatttacatttcat |
22451719 |
T |
|
| Q |
201 |
gcaattaaaaactatcgtgatttttgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22451720 |
gcaattaaaaactatcgtgatttttgt |
22451746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 21790945 - 21790992
Alignment:
| Q |
178 |
tgttgctttaatttacatttcatgcaattaaaaactatcgtgattttt |
225 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
21790945 |
tgttgctttaatttacatttcatataagtaaaaactattgtgattttt |
21790992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University