View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6711_high_8 (Length: 329)
Name: NF6711_high_8
Description: NF6711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6711_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 283
Target Start/End: Original strand, 4717979 - 4718255
Alignment:
| Q |
7 |
tgttcaacttcttcattgcctaataggcaaaagaaagggtttgttgaaccaaaaatgaggaacaaggtgaaaaaacatgtgtcaccaaagaagattcaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4717979 |
tgttcaacttcttcattgcctaatagacaaaagaaagggtttgttgaaccaaaaatgaggaacaaggtgaaaaaacatgtgtcaccaaagaagattcaga |
4718078 |
T |
|
| Q |
107 |
cagaacatagcatggaaaatcttagtcctgtttcagttctagatgtcaatgattatgcttttctctatggagctgatttttcaggtttgttcacttaatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4718079 |
cagaacatagcatggaaaatcttagtcctgtttcagttctagatgtcaatgattatgcttttctctatggagctgatttttcaggtttgttcactcaatc |
4718178 |
T |
|
| Q |
207 |
tcttgttgctattattttttagtgaaccttttctagtttatcaaacattatggggttgcctaattttgtttgtgaaa |
283 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4718179 |
tcttgttgctattattttttagggaaccttttctagtttatcaaacattatggggttgcctaattttgtttgtgaaa |
4718255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University