View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6711_low_16 (Length: 313)
Name: NF6711_low_16
Description: NF6711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6711_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 31 - 294
Target Start/End: Complemental strand, 16077652 - 16077397
Alignment:
| Q |
31 |
taagaaaatattcataaacttttgtaattgcaactcg-ttggtaagcttggatattggtatgcagggttcggggttcgaaccctttagcctttagctcaa |
129 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
16077652 |
taagaaaatattcattaacttttgtaagtgcaactcggttggtaagcttggacattggtatgcagggttcagggttcgaacc-tttagc-tttagctcaa |
16077555 |
T |
|
| Q |
130 |
atcagttgagttatccatcccccttaatacctcaacttagtctttggataattactctctcctattatctttcaatagtttagagactgaattaaagaaa |
229 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16077554 |
atcagttgagttatct----cccttaatacatcaacttagtcgttggataattactctctcctattatctttcaatagtttagagactgaattagtgaaa |
16077459 |
T |
|
| Q |
230 |
aagttaaagttaaacttttaaaacatactactaaattgattaactgtctttttagtatgaagatg |
294 |
Q |
| |
|
|| | ||||||||||||||| |||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
16077458 |
aaatgaaagttaaacttttataaca---tactaaattgattaactatctttttagtctgaagatg |
16077397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University