View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6711_low_17 (Length: 303)
Name: NF6711_low_17
Description: NF6711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6711_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 12 - 280
Target Start/End: Original strand, 28610610 - 28610878
Alignment:
| Q |
12 |
ttggtgttggtgttacttcagcatcagaattcataaatattgccccattagaagtacttgctttaggagtgttgttgcatgtgtggatgccaatgtatgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28610610 |
ttggtgttggtgttacttcagcatcagaattcacaaatattgcctcattagaagtacttgctttaggagtgttgttgcatgtgtggatgccaatgtatgt |
28610709 |
T |
 |
| Q |
112 |
agtttgatacatgtcaggattgtcatgtgtcttttgcacctgtttgattgctgagcaaccttgatcatctttatgtgaacacctgaagtaactcctgtga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28610710 |
agtttgatacatgtcaggattgtcatgtgtcatttgcacctgtttggttgctgagcaaccttgatcatctttatgtgaacacctgaagtaactcctgtga |
28610809 |
T |
 |
| Q |
212 |
gttatattttttaaaaagtgactttttagtttattcatccatgtctagttcattttattgaatctaatt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28610810 |
gttatattttttaaaaagtgactttttagtttattcatccatgtctagttcattttattgaatctaatt |
28610878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 86 - 208
Target Start/End: Complemental strand, 42870727 - 42870605
Alignment:
| Q |
86 |
ttgcatgtgtggatgccaatgtatgtagtttgatacatgtcaggattgtcatgtgtcttttgcacctgtttgattgctgagcaaccttgatcatctttat |
185 |
Q |
| |
|
||||||||||| | ||||||||||||| |||| ||||| || ||||| || | | || ||| ||||||||| ||||| |||||||||||||| || |
|
|
| T |
42870727 |
ttgcatgtgtgaaagccaatgtatgtaatttggtacatttctggattctcttctatcaattgtacctgtttggttgctttgcaaccttgatcatgcttcc |
42870628 |
T |
 |
| Q |
186 |
gtgaacacctgaagtaactcctg |
208 |
Q |
| |
|
| | |||||||||||||||||| |
|
|
| T |
42870627 |
gggtgcacctgaagtaactcctg |
42870605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University