View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6711_low_18 (Length: 264)

Name: NF6711_low_18
Description: NF6711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6711_low_18
NF6711_low_18
[»] chr3 (6 HSPs)
chr3 (14-251)||(11897148-11897405)
chr3 (14-173)||(26432588-26432747)
chr3 (175-252)||(26432769-26432846)
chr3 (115-169)||(23424600-23424654)
chr3 (224-252)||(38647305-38647333)
chr3 (224-252)||(53608423-53608451)
[»] chr8 (3 HSPs)
chr8 (14-251)||(23132475-23132732)
chr8 (19-167)||(14760026-14760174)
chr8 (224-252)||(38348466-38348494)
[»] chr2 (5 HSPs)
chr2 (14-251)||(14653570-14653827)
chr2 (118-169)||(35062956-35063007)
chr2 (121-167)||(35135219-35135265)
chr2 (121-167)||(40328279-40328325)
chr2 (118-175)||(573285-573342)
[»] chr1 (1 HSPs)
chr1 (14-251)||(20284849-20285106)
[»] scaffold0036 (1 HSPs)
scaffold0036 (118-169)||(76006-76057)
[»] chr4 (3 HSPs)
chr4 (121-167)||(54477407-54477453)
chr4 (224-252)||(33803974-33804002)
chr4 (224-252)||(54477530-54477558)
[»] chr6 (3 HSPs)
chr6 (115-169)||(24893833-24893887)
chr6 (115-169)||(24990660-24990714)
chr6 (224-252)||(24893962-24893990)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 11897405 - 11897148
Alignment:
14 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||    
11897405 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttggacgactgctgagttgatagtagc 11897306  T
114 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcgg--------------------aggcggcaacttgttcccattc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                    |||||||||||||||||| |||    
11897305 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcggaggccatgagaaggcttgaaaggcggcaacttgttcccgttc 11897206  T
194 caaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgt 251  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
11897205 caaagtatagagtaactaggagaagctacgcaatgcatgatgagcttgatggtgatgt 11897148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 14 - 173
Target Start/End: Original strand, 26432588 - 26432747
Alignment:
14 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagc 113  Q
    ||||||||| |||||| ||||| ||||||||||||||||||||||| |||||||| || ||| ||||||||||||||| ||| || ||||| ||||||||    
26432588 ggacatcatttgcaaaaaggaggtgggataaatgcggccccgtaggagtgatttgaatcggttcccatcttccttgggtgacggcggagttgatagcagc 26432687  T
114 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcggag 173  Q
     || |||||||||||||||| |||||| |||||||||||||| |||||||||||||||||    
26432688 ggatagcttttccatgcaaatgatgaagagataaggggacaatggatcaccttgtcggag 26432747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 26432769 - 26432846
Alignment:
175 cggcaacttgttcccattccaaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||||||  | |  ||||  || |||||||||||||| ||||||||||||||    
26432769 cggcaacttgttcccattccaaagtatagagtagtttgatgaagagacacaatgcatgatgagtttgatggtgatgtc 26432846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Complemental strand, 23424654 - 23424600
Alignment:
115 gaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtc 169  Q
    ||||||||||||||||| || |||||||||||||| || | ||| ||||||||||    
23424654 gaaagcttttccatgcatagtatgaaaagataaggagagagcgggtcaccttgtc 23424600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 38647305 - 38647333
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
38647305 caatgcatgatgagcttgatggtgatgtc 38647333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 53608423 - 53608451
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
53608423 caatgcatgatgagcttgatggtgatgtc 53608451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 23132475 - 23132732
Alignment:
14 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagc 113  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
23132475 ggacatcatctgcaaataggagatgggataaatggggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagttgatagcagc 23132574  T
114 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcgg--------------------aggcggcaacttgttcccattc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||                    |||||||||||||||||| |||    
23132575 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacgtatcaccttgtcggaggccatgagaaggcttgaaaggcggcaacttgttcccgttc 23132674  T
194 caaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgt 251  Q
    ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||    
23132675 caaagtatagagtaactaggagaagctacgcaatgcatgatgaacttgatggtgatgt 23132732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 167
Target Start/End: Complemental strand, 14760174 - 14760026
Alignment:
19 tcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagctgaaa 118  Q
    |||||||||||||| || || ||||  || |||||||||   |||||||| |  ||| |||| ||||||||   ||| ||||| |||||||||   || |    
14760174 tcatctgcaaatagtaggtgagatatctggggccccgtatttgtgatttgaaccggttcccaacttccttgattgaccgctgaatttatagcaatagaga 14760075  T
119 gcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttg 167  Q
    |||||||||| ||||| ||||| || || |||||||||||||| |||||    
14760074 gcttttccatacaaagaatgaagaggtatggggacaacggatctccttg 14760026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 38348494 - 38348466
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
38348494 caatgcatgatgagcttgatggtgatgtc 38348466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 14653570 - 14653827
Alignment:
14 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagc 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||    
14653570 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggagtgatttggatgggtgcccatcttccttgggcaactgctgagtttatagcagc 14653669  T
114 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcgg--------------------aggcggcaacttgttcccattc 193  Q
     || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||                    ||||||||||||||||||||||    
14653670 ggatagcttttccatgcaaaggatgaaaaaataaggggacaacggatcaccttgttggaggccatgagaaggcttgaaaggcggcaacttgttcccattc 14653769  T
194 caaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgt 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14653770 caaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgt 14653827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 118 - 169
Target Start/End: Original strand, 35062956 - 35063007
Alignment:
118 agcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtc 169  Q
    ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||    
35062956 agcttttccatacaaaggatgaaaagatagggggatagtggatcaccttgtc 35063007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Original strand, 35135219 - 35135265
Alignment:
121 ttttccatgcaaaggatgaaaagataaggggacaacggatcaccttg 167  Q
    |||||||| || ||||||||||||||||| |||||||| ||||||||    
35135219 ttttccatacataggatgaaaagataaggagacaacgggtcaccttg 35135265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Complemental strand, 40328325 - 40328279
Alignment:
121 ttttccatgcaaaggatgaaaagataaggggacaacggatcaccttg 167  Q
    |||||||| || ||||||||||||||||| |||||||| ||||||||    
40328325 ttttccatacataggatgaaaagataaggagacaacgggtcaccttg 40328279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 118 - 175
Target Start/End: Complemental strand, 573342 - 573285
Alignment:
118 agcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcggaggc 175  Q
    ||||| ||||||||||||||||| || ||||| || | |||||||||||||| |||||    
573342 agcttctccatgcaaaggatgaataggtaaggagagagcggatcaccttgtctgaggc 573285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 20285106 - 20284849
Alignment:
14 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagtttatagcagc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
20285106 ggacatcatctgcaaataggagatgggataaatgcggccccgtaggggtgatttggatgggtgcccatcttccttgggcgactgctgagttgatagcagc 20285007  T
114 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcg--------------------gaggcggcaacttgttcccattc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                     ||||||||||   ||||| |||    
20285006 tgaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtcgcaggccatgagaaggctcgaaaggcggcaaccctttcccgttc 20284907  T
194 caaagtatagagtaactcggagaagctacgcaatgcatgatgagcttgatggtgatgt 251  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
20284906 caaagtatagagtaactaggagaagctacgcaatgcatgatgagcttgatggtgatgt 20284849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 118 - 169
Target Start/End: Complemental strand, 76057 - 76006
Alignment:
118 agcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtc 169  Q
    ||||||||||||||||||||||||||||||||||||||| | ||||||||||    
76057 agcttttccatgcaaaggatgaaaagataaggggacaactggtcaccttgtc 76006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 121 - 167
Target Start/End: Original strand, 54477407 - 54477453
Alignment:
121 ttttccatgcaaaggatgaaaagataaggggacaacggatcaccttg 167  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||    
54477407 ttttccatgcaaagaatgaagagataaggggacaaaggatcaccttg 54477453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 33804002 - 33803974
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
33804002 caatgcatgatgagcttgatggtgatgtc 33803974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 54477530 - 54477558
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
54477530 caatgcatgatgagcttgatggtgatgtc 54477558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Original strand, 24893833 - 24893887
Alignment:
115 gaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtc 169  Q
    ||||||||||||||||| || |||||||||||||| || | ||| ||||||||||    
24893833 gaaagcttttccatgcatagtatgaaaagataaggagagagcgggtcaccttgtc 24893887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Original strand, 24990660 - 24990714
Alignment:
115 gaaagcttttccatgcaaaggatgaaaagataaggggacaacggatcaccttgtc 169  Q
    |||||||| ||||||||||| |||||||||||||| || | ||| ||||||||||    
24990660 gaaagcttctccatgcaaagaatgaaaagataaggagagagcgggtcaccttgtc 24990714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 24893962 - 24893990
Alignment:
224 caatgcatgatgagcttgatggtgatgtc 252  Q
    |||||||||||||||||||||||||||||    
24893962 caatgcatgatgagcttgatggtgatgtc 24893990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University