View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6711_low_25 (Length: 232)

Name: NF6711_low_25
Description: NF6711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6711_low_25
NF6711_low_25
[»] chr8 (1 HSPs)
chr8 (1-139)||(3684534-3684672)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 3684534 - 3684672
Alignment:
1 cactatgtggggtgcttgtttgggtgtctttaagtggggttgttcgagtctgcttgcttatcacttgtgtctcttcgctctggtggagtatgcttgatcc 100  Q
    |||| |||||||||||||||||||||||||||||||||||| |||||  |||||| ||||||||||||||||||||||||||||||||||||||||||||    
3684534 cactgtgtggggtgcttgtttgggtgtctttaagtggggtttttcgaacctgcttccttatcacttgtgtctcttcgctctggtggagtatgcttgatcc 3684633  T
101 attcttcctttgattttgggcactaggagtgtggtagga 139  Q
    |||||||||||||||||||||| ||||||||||||||||    
3684634 attcttcctttgattttgggcaataggagtgtggtagga 3684672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University