View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6713_high_10 (Length: 206)
Name: NF6713_high_10
Description: NF6713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6713_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 43381377 - 43381558
Alignment:
| Q |
18 |
atgaaccaattaacaccccagggatgattattagaaatacaagtatataagataaaccacttcggtttgcattcctgtgaaaaatccaacgtcattc-tt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43381377 |
atgaaccaattaacaccccagggatgattattagaaatagaagtatacaagataaaccacttcggtttgcattcctgtgaaaaatccaacgtcattcttt |
43381476 |
T |
 |
| Q |
117 |
tttattctattctata---------acttgtgttatatgcaggaccaatgttagattatttgctgagtatttattttgaatt |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43381477 |
tttattctattctataagataaatcacttgtgttatatgcaggaccaatgttagattatttgctgagtatttattttgaatt |
43381558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 25871008 - 25871064
Alignment:
| Q |
133 |
acttgtgttatatgcaggaccaatgttagattatttgctgagtatttattttgaatt |
189 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25871008 |
acttgtattatatgcaggaccaatgttagattatttgctgagtatttattttgaatt |
25871064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 25870950 - 25871011
Alignment:
| Q |
18 |
atgaaccaattaacaccccagggatgattattagaaatacaagtatataagataaaccactt |
79 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
25870950 |
atgaaccaattaacaacgcagggatgattattagaaatagaagtatataagataaatcactt |
25871011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University