View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6713_high_3 (Length: 379)
Name: NF6713_high_3
Description: NF6713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6713_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 182 - 374
Target Start/End: Original strand, 6032871 - 6033063
Alignment:
| Q |
182 |
gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctgatatttttcagcatattctgagatcataagaatgaat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032871 |
gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctgatatttttcagcatattctgagatcataagaatgaat |
6032970 |
T |
 |
| Q |
282 |
tattctaaaagtgcttttacaaagaatcgttttcatatggagacatttcattttctgttctatttttccctttagacaatgtctgtattctgt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032971 |
tattctaaaagtgcttttacaaagaatcgttttcatatggagacatttcattttctgttctatttttccctttagacaatgtctgtattctgt |
6033063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 6032684 - 6032802
Alignment:
| Q |
1 |
caatgatgctgccactggaagatccaacttttctgcaatatcaagaatgaatctatcatcaggtaactagtgtttttctttatttgataattgtttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032684 |
caatgatgctgccactggaagatccaacttttctgcaatatcaagaatgaatctatcatcaggtaactagtgtttttctttatttgataattgtttcact |
6032783 |
T |
 |
| Q |
101 |
gtttcaaaacataaaatta |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6032784 |
gtttcaaaacataaaatta |
6032802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 218
Target Start/End: Original strand, 6712976 - 6713012
Alignment:
| Q |
182 |
gggcttcaaatctttggaaaatcatgggaggattgca |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
6712976 |
gggctccaaatctttggaaaatcatgggaggaatgca |
6713012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University