View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6713_low_12 (Length: 243)
Name: NF6713_low_12
Description: NF6713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6713_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 7215889 - 7216091
Alignment:
| Q |
21 |
caaccttcatatctagtactattacaacaccttaggcaatcatctcaacaaaactattgatttcatatgatattttttatacaactagacatatagtgtg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7215889 |
caaccttcatatctagtactattacaacaccttaggcaatcatctcaacaaaactattgatttcatatgatattttttatacaactagacatatagtgtg |
7215988 |
T |
 |
| Q |
121 |
tttggaattgtggtcaagttacttcagacacatcaccattctcacatcaaaaacaactttaagatgcgagaaaaacgattagaaggtgaatcgaaacata |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7215989 |
tttggtattgtggtcaagttacttcagacacatcaccattctcacatcaaaaacaactttgggatgcgagaaaaacgattagaaggtgaattgaaacata |
7216088 |
T |
 |
| Q |
221 |
gtt |
223 |
Q |
| |
|
||| |
|
|
| T |
7216089 |
gtt |
7216091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University