View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6713_low_13 (Length: 241)
Name: NF6713_low_13
Description: NF6713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6713_low_13 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 241
Target Start/End: Complemental strand, 32096904 - 32096800
Alignment:
| Q |
137 |
tcccaatgcctcctcaaatacatcctcttcacagtcccgtacctccacaccaaaaaccatgacgaaannnnnnntcaaactcatgatgccggcgttgacc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
32096904 |
tcccaatgcctcctcaaatacatcctcttcacagtcccatacctccacaccaaaaaccatgacgaaacctcccctcaaactcatgatgcaggcgttgacc |
32096805 |
T |
 |
| Q |
237 |
cctcc |
241 |
Q |
| |
|
||||| |
|
|
| T |
32096804 |
cctcc |
32096800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 32097021 - 32096969
Alignment:
| Q |
20 |
atcgattcttcaccttccatcaactacatcacttcctctaaccaatcctcttt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32097021 |
atcgattcttcaccttccatcaactacatcacttcctctaaccaatcctcttt |
32096969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University