View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_high_11 (Length: 331)
Name: NF6715_high_11
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 331
Target Start/End: Original strand, 3705988 - 3706308
Alignment:
| Q |
11 |
acatcaacaggattggaaacaattagaagaacacaatgaggagagtaacgaaccaaaggcggtataannnnnnnaaacaaagctacattcctttgtagca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3705988 |
acatcaacaggattggaaacaattagaagaacacaatgaggagagtaacgaaccaaaggcggtataatttttttaaacaaagctacattcctttgtagca |
3706087 |
T |
|
| Q |
111 |
aattcaatctggactcgccattaatctggcgagccccagcagtgacgatgcagaggtcagaccccatcgtcactgaatagtcagtggaggcctggatctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3706088 |
aattcaatctggactcgccattaatctgacgagccccagcagtgacgatgcagaggtcggaacccatcgtcactgaatagtcagtggaggcctggatctt |
3706187 |
T |
|
| Q |
211 |
agtacgggggaggaaggccgcagcatgttgtagatctagcatctcacctcgtagtttgtcaggaatggtgtcaacaagaacaagctcgtcgactaggtct |
310 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3706188 |
agtgcgggggaggaaggccgcagcatgttgtagatccagcatctcacctcgtagtttgtcaggaatggcgtcaacaagaacaagctcgtcgactaggtct |
3706287 |
T |
|
| Q |
311 |
tgtgttaggatggtttgagct |
331 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3706288 |
tgtgttaggatggtttgagct |
3706308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University