View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_high_14 (Length: 306)
Name: NF6715_high_14
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 2 - 298
Target Start/End: Complemental strand, 43960687 - 43960391
Alignment:
| Q |
2 |
catttatgcttgcaagcaaggttcctattgactccacacgcaattcaatttttaaaactcacgtgttaccagttcatataatttggttctcggtcaacct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
43960687 |
catttatgcttgcaagcaaggttcctattgactccacacgcaattcaatttttaaaactcacgtgttaccagttcatataatttgattcccggtcaacct |
43960588 |
T |
|
| Q |
102 |
ttgcagattcctattgcactggatatggcagctcaatttcgaggtggggaccctgatctttggaagcgcatatgtggagacgaatatatgaaatgtgcgg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960587 |
ttgcagattcctattgcactggatatggcagctcaatttcgaggtagggactctgatctttggaagcgcatatgtggagacgaatatatgaaatgtgcgg |
43960488 |
T |
|
| Q |
202 |
tgcttgaatgctatgaatctttccaacaaattttgaacactttagtgattggagaagctgaaaaaaggtggcttttagtatctttcctgttgatgtc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960487 |
tgcttgaatgctatgaatctttccaacaaattttgaacactttagtgattggagaagctgaaaaaaggtggcttttagtatctttcctgttgatgtc |
43960391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 94 - 270
Target Start/End: Complemental strand, 39162512 - 39162336
Alignment:
| Q |
94 |
gtcaacctttgcagattcctattgcactggatatggcagctcaatttcgaggtggggaccctgatctttggaagcgcatatgtggagacgaatatatgaa |
193 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
39162512 |
gtcaacctttacagattcctgtagcactggatatggcaactcaatttcgagggagggactctgatctttggaagcgcatatgtgcagatgaatatatgaa |
39162413 |
T |
|
| Q |
194 |
atgtgcggtgcttgaatgctatgaatctttccaacaaattttgaacactttagtgattggagaagctgaaaaaaggt |
270 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||| | || ||| ||||| |||||| |||||||||||| |
|
|
| T |
39162412 |
atgtgctgtaattgaatgctatgaatcttttaaacaaattctacacgatttggtgataggagaaactgaaaaaaggt |
39162336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University