View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_high_16 (Length: 287)
Name: NF6715_high_16
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_high_16 |
 | |
|
| [»] scaffold0152 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0152 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 12907 - 13129
Alignment:
| Q |
1 |
taatgctttttatgaaactaagctaattcttgatgatgatttctgaaaaatcctaccagttattatcccaaaaggaacaaggcaagaaatagttcttgca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12907 |
taatgctttttacgaaactaagctaattcttgatgatgatttttgaaaaatcctaccagttat---cccaaaaggaacaaggcaagaaatagttcttgca |
13003 |
T |
|
| Q |
101 |
ccaataaattcttcatcgttgtggaatcattgtgaagttttgacacttacaactaatatgcggtttttacgtggttgcataaccggtgacaacattggag |
200 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13004 |
ccaatgaattcttcatcgttgtggaattattgtgaagttttgacacttgcaactaatatgcggcttttacgtggctgcataaccggtgacaacattggag |
13103 |
T |
|
| Q |
201 |
agaaggtttacatacctagattgtca |
226 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
13104 |
agaaggtttacatacatagattgtca |
13129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University