View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_high_17 (Length: 283)
Name: NF6715_high_17
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_high_17 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 82 - 283
Target Start/End: Complemental strand, 7926691 - 7926486
Alignment:
| Q |
82 |
tgtggagcccaaaaatttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg |
181 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7926691 |
tgtggagcccaaaattttctgttttgattttgatgcattattacttgcatgtgtgttcacgtgggaactgtggtggcctttgcagggtggtagggagtgg |
7926592 |
T |
|
| Q |
182 |
ttatggttacacgaatgtcatac----ttacagggtggattaggaaagtactgtctttgagatctattttttgtcatgtttttgggatcatgtcctacaa |
277 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
7926591 |
ttatggttacacgaatgtcatacttacttacagggtggattaggaaagtactgtctttgagatctattttatgtcatgtttttgggatcatgtcctagaa |
7926492 |
T |
|
| Q |
278 |
gttcat |
283 |
Q |
| |
|
|||||| |
|
|
| T |
7926491 |
gttcat |
7926486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 7926733 - 7926792
Alignment:
| Q |
1 |
cgaaatctccaaattaaaatttactcctccgatcttatgcataaaagaaatttcaaaaaa |
60 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
7926733 |
cgaaatctccaaattaaaacttactcctctggtcttatgtataaaagaaatttcaaaaaa |
7926792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University