View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_high_24 (Length: 220)
Name: NF6715_high_24
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_high_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 2 - 220
Target Start/End: Original strand, 31814094 - 31814301
Alignment:
| Q |
2 |
cacctcaccttgaacgaaacaaacaaaaactccctccctcaccctataactaaaattgaggtggtggatgccctcaactctatgaagtctttcaaattcc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| || |||| |||| ||| || | |||||||||||||||||||||||| || |
|
|
| T |
31814094 |
cacctcaccttgaacgaaacaaacaaaaactccctcactcgccatatatctaa---tgaagtctt--------tcaactctatgaagtctttcaaatccc |
31814182 |
T |
 |
| Q |
102 |
ctggtttagatgagtttaaatatatctttttcaaacagtattagcacattgtaggagatgacaccttcaagtttgtccacgcaacctttgaaactggcca |
201 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31814183 |
ctagtttagatgagtttaaatatatctttttcaaacagtattagcacattgtaggagatgacaccttcaagtttgtccacacaacctttgaaactggcca |
31814282 |
T |
 |
| Q |
202 |
ttttgacccaaccacctca |
220 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
31814283 |
ttttgacccagccacctca |
31814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University