View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_low_18 (Length: 292)
Name: NF6715_low_18
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 125 - 268
Target Start/End: Complemental strand, 43510740 - 43510593
Alignment:
| Q |
125 |
ggtattggtgactaagaaacttggtgatggattgaagaggaagaaaatccattgatgaaaactcaaagcttgta----tttcagttacacttataatgtt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43510740 |
ggtatcggtgactaagaaacttggtgatggattgaagagaaagaaaatccattgatgaaaactcaaagcttgtattattttcagttacacttataatgtt |
43510641 |
T |
 |
| Q |
221 |
cagaagagaattgttgactattgtttaagggttcccacattggatata |
268 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43510640 |
cagaagagaattattgactattgtttaagggttcccacattggatata |
43510593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 43510843 - 43510807
Alignment:
| Q |
21 |
gttgacgtgtctttgatggtactaatgcgacaagtcc |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43510843 |
gttgacgtgtctttcatggtactaatgcgacaagtcc |
43510807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University