View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6715_low_20 (Length: 287)

Name: NF6715_low_20
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6715_low_20
NF6715_low_20
[»] scaffold0152 (1 HSPs)
scaffold0152 (1-226)||(12907-13129)


Alignment Details
Target: scaffold0152 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: scaffold0152
Description:

Target: scaffold0152; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 12907 - 13129
Alignment:
1 taatgctttttatgaaactaagctaattcttgatgatgatttctgaaaaatcctaccagttattatcccaaaaggaacaaggcaagaaatagttcttgca 100  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||||||||    
12907 taatgctttttacgaaactaagctaattcttgatgatgatttttgaaaaatcctaccagttat---cccaaaaggaacaaggcaagaaatagttcttgca 13003  T
101 ccaataaattcttcatcgttgtggaatcattgtgaagttttgacacttacaactaatatgcggtttttacgtggttgcataaccggtgacaacattggag 200  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||    
13004 ccaatgaattcttcatcgttgtggaattattgtgaagttttgacacttgcaactaatatgcggcttttacgtggctgcataaccggtgacaacattggag 13103  T
201 agaaggtttacatacctagattgtca 226  Q
    ||||||||||||||| ||||||||||    
13104 agaaggtttacatacatagattgtca 13129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University