View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6715_low_24 (Length: 238)
Name: NF6715_low_24
Description: NF6715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6715_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 12145617 - 12145852
Alignment:
| Q |
1 |
aaatgaaagaggaaata--acattacaagtatatttttaaacggtttaatttacaagcaaagattttcagttttattatatatctattacaaccacatac |
98 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
12145617 |
aaatgaaagagaaaatataacattacaagtatatttttagacggtttaatttacaagcaaagatttccagttttattacatatctattacaactacatac |
12145716 |
T |
 |
| Q |
99 |
acttcatattctcatgaagttttattcatac---ttattattactagaagaacacactttcagactttttagtactacaagtttctatcctttgtgatta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12145717 |
acttcatattctcatgaagttttattcatacttattattattactagaagaacacacttttagactttttagtactacaagtttctatcctttgtgctta |
12145816 |
T |
 |
| Q |
196 |
gttgtgaggttcagcatcaatatcagcaacatgatg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145817 |
gttgtgaggttcagcatcaatatcagcaacatgatg |
12145852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University